| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.031075 |
| Chromosome: | chromosome 15 |
| Location: | 804297 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g637761 | ABCD1 | Peroxisomal long-chain acyl-CoA transporter, ABC superfamily; (1 of 1) K05677 - ATP-binding cassette, subfamily D (ALD), member 3 (ABCD3, PMP70) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCTGTAACCCCAACCTCCGCCTCGCCCCAACTCCCAACACCTCCCAAC |
| Internal bar code: | AACTAATCATGGGGTCCTCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 114 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCCACACCGAACACAAACA |
| Suggested primer 2: | GTGTGCAAGTTGCCTGACAG |