| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.031076 |
| Chromosome: | chromosome 2 |
| Location: | 729459 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g078100 | EIF5Ba,EIF5B1 | (1 of 1) K03243 - translation initiation factor 5B (EIF5B); Eukaryotic initiation factor, eIF-5B | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCGCAGGGCCTCAAGTCGAAGCTGCCTGGTGCGGAGGAGGAGGCTGAG |
| Internal bar code: | AGGTAAGATATTCACTCGAATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2039 |
| LEAP-Seq percent confirming: | 91.8919 |
| LEAP-Seq n confirming: | 34 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCCTGACCCAGTCCATTC |
| Suggested primer 2: | ACGCACATAACACCTCTGGG |