Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.031113 |
Chromosome: | chromosome 12 |
Location: | 1583658 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g487200 | (1 of 5) IPR001680//IPR011047//IPR017986//IPR020472 - WD40 repeat // Quinonprotein alcohol dehydrogenase-like superfamily // WD40-repeat-containing domain // G-protein beta WD-40 repeat | 5'UTR | |
Cre12.g487250 | (1 of 1) PF06454 - Protein of unknown function (DUF1084) (DUF1084) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGTGTAAAACAGTATCTGCAAACGTGCTAGCCGTCTGCCCTAGCTCTC |
Internal bar code: | AGTGAGTGCATCCCGGCCAGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4295 |
LEAP-Seq percent confirming: | 34.2857 |
LEAP-Seq n confirming: | 36 |
LEAP-Seq n nonconfirming: | 69 |
LEAP-Seq n unique pos: | 105 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACGCTCGATGCCTCCATTC |
Suggested primer 2: | CTGTGGAGCAGGAGGAAAGG |