| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.031200 |
| Chromosome: | chromosome 1 |
| Location: | 4641912 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g032100 | (1 of 1) K10570 - DNA excision repair protein ERCC-8 (ERCC8, CKN1, CSA) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAAGGAAGCGTTGTGGCGGGTGGCGGCCAATGCGTGCTGGTCGTTCCCC |
| Internal bar code: | AAGGCCGTACGGTTAGGTCTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2613 |
| LEAP-Seq percent confirming: | 53.7313 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCCACAACCGTGCAACAG |
| Suggested primer 2: | TAGTGCGGTTTGCTGTACGT |