| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.031239 |
| Chromosome: | chromosome 9 |
| Location: | 4684499 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g402034 | UBA4 | (1 of 1) 2.7.7.80//2.8.1.11 - Molybdopterin-synthase adenylyltransferase // Molybdopterin-synthase sulfurtransferase / Molybdopterin synthase sulfurylase; URM1 E1 activating enzyme | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGGGGCAAAATGGTTGGGCTCACCTGGGTTTTCGCGCTCCCAAGCTCC |
| Internal bar code: | GTAAGTACGGTGCAGGCCTACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1191 |
| LEAP-Seq percent confirming: | 86.9565 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGCCCATGGAAGCAGGTA |
| Suggested primer 2: | CAAGTGTGTACCACCCCTCC |