| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.031289 |
| Chromosome: | chromosome 16 |
| Location: | 345688 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g693950 | GOX19,GOX20 | Glyoxal oxidase 20; (1 of 1) 1.1.3.9//2.7.11.1 - Galactose oxidase / Beta-galactose oxidase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTCCCGTATCCCCCCCCCCCACCGCAACCCCCGCCGTCACAACCCCAC |
| Internal bar code: | AGCCGGCAAATCATTGGGTTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 104 |
| LEAP-Seq percent confirming: | 4.65116 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTTCCCACCCTCACCCATC |
| Suggested primer 2: | CGCATGGTATTTTGAGGCCG |