| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.031300 |
| Chromosome: | chromosome 6 |
| Location: | 1094237 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g257550 | UCP2,UCP2A | (1 of 3) K15103 - solute carrier family 25 (mitochondrial uncoupling protein), member 8/9 (UCP2_3, SLC25A8_9); Mitochondrial uncoupling protein 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACTCCTGGCCTGGCCGGCACGACGTCCCCCGCCAGTCGCGTCCACGCTC |
| Internal bar code: | AGAGATTCCCTTTGCGGTGTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 6450 |
| LEAP-Seq percent confirming: | 97.2222 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTAGTGTTGTCCTTGGCCT |
| Suggested primer 2: | ATTGCGCAAAACAAGGGCTT |