| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.031428 |
| Chromosome: | chromosome 12 |
| Location: | 1110860 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g491150 | VPS55 | (1 of 1) PF04133 - Vacuolar protein sorting 55 (Vps55); Vacuolar trafficking protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCATCGGCGCGCTAATCATGGAGCTGGCTGCGGCGCTGGTGCTTGGGG |
| Internal bar code: | TCTATTTTGTGATCGACGAAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 626 |
| LEAP-Seq percent confirming: | 55.5556 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAGACATGTGGAGTGCGT |
| Suggested primer 2: | AAGTTCCTCACCGGCTTCAG |