| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.031442 |
| Chromosome: | chromosome 11 |
| Location: | 3693279 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g478700 | FKB15D,FKB15-4,FKB3 | Peptidyl-prolyl cis-trans isomerase, FKBP-type; (1 of 3) K09569 - FK506-binding protein 2 [EC:5.2.1.8] (FKBP2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGGCTCGCCGCGCTTGAACGAGTTGTCGAACTCCTTGCCGTCCTCCAG |
| Internal bar code: | ACTATAAGGGACATTCGGTCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2064 |
| LEAP-Seq percent confirming: | 98.8235 |
| LEAP-Seq n confirming: | 84 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 85 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGACAAAGGACAGCGAGACA |
| Suggested primer 2: | GAGCAGGTCACGGGGATATG |