Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.031493 |
Chromosome: | chromosome 17 |
Location: | 3710189 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g726000 | PAP3 | Class-II RNA nucleotidyl transferase 3, mitochondrial; (1 of 2) 2.7.7.72 - CCA tRNA nucleotidyltransferase / tRNA-nucleotidyltransferase | intron |
Cre17.g726050 | Similar to Ubiquitin-Specific Protease; (1 of 1) K11843 - ubiquitin carboxyl-terminal hydrolase 14 [EC:3.4.19.12] (USP14, UBP6) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGGCTGGGACAGATCCACCTCAATGTCATTAAATGACTCTTTGCCCCA |
Internal bar code: | TGTTTGGTGTCTGAATTCATGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2464 |
LEAP-Seq percent confirming: | 52.0833 |
LEAP-Seq n confirming: | 25 |
LEAP-Seq n nonconfirming: | 23 |
LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGTTGGGGGTTTTGGCAGA |
Suggested primer 2: | CGCACCTTGACCTTCTCCTT |