Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.031567 |
Chromosome: | chromosome 15 |
Location: | 1276332 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g801727 | NCL66 | Nuclear Control of chloroplast-Like 66; (1 of 39) PF08373 - RAP domain (RAP) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCAGCCGCCGCAGCAGGTAGGCCTCCTGAGCGGAAGGCGTCCTCAGA |
Internal bar code: | CGGACACTTTGTATAGCCGGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3677 |
LEAP-Seq percent confirming: | 92.5373 |
LEAP-Seq n confirming: | 62 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGAGGCAATGTACAGGAGT |
Suggested primer 2: | ATCACCCATCACCCTAGCCT |