| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.031753 |
| Chromosome: | chromosome 8 |
| Location: | 414048 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g358616 | FAP398 | Flagellar Associated Protein 398; (1 of 70) 3.1.3.16 - Protein-serine/threonine phosphatase / Serine/threonine specific protein phosphatase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGGTGGGGTGGTAGGACACGTAGCGGCTGAAGTCTGCGTCGCCGATGG |
| Internal bar code: | TGGGGAACGTTACCTTCACACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 279 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTATGGGGTTGGGGTTCAGG |
| Suggested primer 2: | AATCACACGCTTTCGACCCT |