| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.031820 |
| Chromosome: | chromosome 4 |
| Location: | 3586847 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g228550 | (1 of 2) PTHR31140//PTHR31140:SF1 - FAMILY NOT NAMED // B3 DOMAIN-CONTAINING TRANSCRIPTION FACTOR ABI3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGGGGCTAGAGCGGCAAGTAACACCCCGTTCCAAACGCCCCCGCCCCT |
| Internal bar code: | CAGTCGCTAGGTAACGAAGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1125 |
| LEAP-Seq percent confirming: | 88.4615 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTCTTGTTGCTTGCTGGG |
| Suggested primer 2: | CGTGCGGGCGTGTAAATAAG |