Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.031842 |
Chromosome: | chromosome 6 |
Location: | 3889197 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g278187 | MOT4 | (1 of 1) K15716 - E3 ubiquitin-protein ligase ZSWIM2 [EC:6.3.2.19] (ZSWIM2); Predicted protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACACAAAGGGGTGACCCTGCCGAGGTCACCGGTGTGGTCTAGGGTTGGT |
Internal bar code: | GGCCTTCGGCGAAATAATATGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1672 |
LEAP-Seq percent confirming: | 98.0 |
LEAP-Seq n confirming: | 49 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGGCACTTATGACACCCAG |
Suggested primer 2: | GGTGACGAGCATACCGGTAG |