| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.031874 |
| Chromosome: | chromosome 6 |
| Location: | 6146897 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g291700 | RSP3,PF14 | (1 of 1) PF06098 - Radial spoke protein 3 (Radial_spoke_3); Radial spoke protein 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGGGCTCCGGGGCAGTGTGCCCACTCACGTCGATGCCGGCGAGGGTCC |
| Internal bar code: | TAGTATGCGTCTGCCTCTGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 6011 |
| LEAP-Seq percent confirming: | 99.0991 |
| LEAP-Seq n confirming: | 110 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 111 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCGCCTGAGAGAGGATTC |
| Suggested primer 2: | CGTTGCGAATCTGCTCGAAG |