Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.031875 |
Chromosome: | chromosome 3 |
Location: | 6914263 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g198200 | GTR11,GSL4,GTR13,BGS4 | (1 of 4) K00706 - 1,3-beta-glucan synthase (E2.4.1.34); Glucan synthase-like 4 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAAGGTGCGGTGCATTGCTTCCCCAGCTATAACTGAAAGATCGATTCT |
Internal bar code: | GGTTGCGAATAGGCAGCGTGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1702 |
LEAP-Seq percent confirming: | 96.4286 |
LEAP-Seq n confirming: | 27 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCCTTGACTGTCATGCTCT |
Suggested primer 2: | CATATGTTGCAGTCGTGGCG |