| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.031940 |
| Chromosome: | chromosome 6 |
| Location: | 2349564 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g267800 | MML1,MITC8,MCP8 | (1 of 1) K15119 - solute carrier family 25, member 39/40 (SLC25A39_40); MTM-Like Mn transporter 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAGATTGCTGTCCGCTGGAAGACGGGCGCTTGACCACATGCGCCACAA |
| Internal bar code: | TTGTCGTATATGTCTAGAATTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1643 |
| LEAP-Seq percent confirming: | 93.3333 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGACAACATCGCAAGCTAGC |
| Suggested primer 2: | AGCTTCATCGACAGTGGTGG |