| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.031943 |
| Chromosome: | chromosome 17 |
| Location: | 884018 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g702451 | HLM27 | putative N-methyltransferase; (1 of 1) PTHR22884:SF348 - PROTEIN SET-25 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACGTGCATTACTGCCTTGAAAACCGGCGTCACTGACAAGCTCCCTGGT |
| Internal bar code: | GGGTGTCTAACGGGTATCCCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1144 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCCGCTCATCCTCTGTTG |
| Suggested primer 2: | AACACTAGGACGTGTGCTGG |