Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.032023 |
Chromosome: | chromosome 9 |
Location: | 932534 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g403000 | PAP9 | (1 of 3) K03514 - non-canonical poly(A) RNA polymerase PAPD5/7 (PAPD5_7, TRF4); Class-II RNA nucleotidyl transferase 9 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGCCTATGGGCCCTGCAGGCGGCCCCGCGTACGGCGTCGTTGGCCAGG |
Internal bar code: | GGTCGCGGTAATCAGAATACAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1790 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGTACGACCCACATCGC |
Suggested primer 2: | CAAGGACGTCTGAACACGGA |