| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.032030 |
| Chromosome: | chromosome 3 |
| Location: | 5535941 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g185050 | FAP53,CFAP53 | Flagellar Associated Protein 53; (1 of 1) PTHR31183:SF1 - COILED-COIL DOMAIN-CONTAINING PROTEIN 11 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCATCATAAGCGCCAGCTGCTCGCGGTAGCGCCGCATTTCCTCACGGCG |
| Internal bar code: | CTAAATATTCACCGGACACTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4713 |
| LEAP-Seq percent confirming: | 99.0 |
| LEAP-Seq n confirming: | 99 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 100 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGGCAAAAGATGGAGCAAA |
| Suggested primer 2: | GGTACCCACAGTCGAAGCAA |