| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.032103 |
| Chromosome: | chromosome 1 |
| Location: | 6995814 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g049950 | VLE1,SPO | Sporangin (Vegetative Lytic Enzyme 1); (1 of 14) 3.4.21.62 - Subtilisin | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGCGGGCATAGCCATACACCACATAGTTGGCGGGGTTGAGCATGGCGG |
| Internal bar code: | GCGTGGCGTCCCGGTGGCCCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5014 |
| LEAP-Seq percent confirming: | 91.5966 |
| LEAP-Seq n confirming: | 109 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 119 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGTCGCCGACAAGTGAGT |
| Suggested primer 2: | GGTAGATCTCGTGCGACTGG |