| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.032186 |
| Chromosome: | chromosome 13 |
| Location: | 835107 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g567250 | (1 of 2) IPR007087//IPR015880 - Zinc finger, C2H2 // Zinc finger, C2H2-like | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTGGACGGTACATGACTTTTTGCTAGGCGAACAAACAATGCATGGTGG |
| Internal bar code: | TAGTGAGCGTCTATGCGTGATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1768 |
| LEAP-Seq percent confirming: | 67.3913 |
| LEAP-Seq n confirming: | 31 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTCAAGCGGGGAAAGGTA |
| Suggested primer 2: | TGTGGAGGTAGTGGTGACCA |