| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.032238 |
| Chromosome: | chromosome 17 |
| Location: | 1014198 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g703250 | TPT28,TPT29 | UDP-galactose/glucose transporter; (1 of 2) K15281 - solute carrier family 35 (SLC35D) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGCTGTAGGCGCTCAAGGGCTTTCGGGCTGGCGTTGGTTATTAAGAAT |
| Internal bar code: | AAGGTACAGGCAACGTCGCTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 445 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACACACGCACCTTGACTG |
| Suggested primer 2: | CCAGTCAGGGAGGGGATACA |