| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.032281 |
| Chromosome: | chromosome 11 |
| Location: | 1893734 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467786 | (1 of 1) 1.14.13.15 - Cholestanetriol 26-monooxygenase / Vitamin D(3) 25-hydroxylase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCACCCGCACGGCGGCGGCGGCCGTCGGCGCCGACGGCGCCGCGCCGA |
| Internal bar code: | GGATTAGGTCCTGTAACAAACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2648 |
| LEAP-Seq percent confirming: | 83.0508 |
| LEAP-Seq n confirming: | 49 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCTCCGTTTCGTTGCTTG |
| Suggested primer 2: | GTGGCCAGACGTGTTCTACA |