| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.032296 |
| Chromosome: | chromosome 10 |
| Location: | 683548 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g422201 | CTP4 | Copper transporting ATPase; (1 of 2) K01533 - Cu2+-exporting ATPase (copB) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCCCAGGGCGGCGGCGCCTGATCCGGAACACAGGGAAGGAGGGGCTTA |
| Internal bar code: | TGGACGTGTCAGGGCCATAGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1023 |
| LEAP-Seq percent confirming: | 88.8889 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGGTTAGGTTGGGATTGGC |
| Suggested primer 2: | AGCTCACACACACACACACA |