Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.032320 |
Chromosome: | chromosome 8 |
Location: | 4093366 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g383150 | ROC97,NAT3,NAT5 | N-acetyl-transferase 3; (1 of 1) K17972 - N-terminal acetyltransferase B complex catalytic subunit [EC:2.3.1.88] (NAA20, NAT3) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTAAACTTGGGTGGGTGGAGGAATGTTAGAGAGCGCCAAGAGACGTGT |
Internal bar code: | TCTTGGGGTAAGGTGTGCCGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 173 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTCACCCATACATGTGGCC |
Suggested primer 2: | CTTGAGAGCGTGTGGACACT |