| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.032357 |
| Chromosome: | chromosome 14 |
| Location: | 1654000 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g618700 | uS7m,MRPS7 | Mitochondrial ribosomal protein S7; (1 of 2) K02992 - small subunit ribosomal protein S7 (RP-S7, MRPS7, rpsG) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTTGTATAGATAGTCGATTACAATGCATAAAGCATTTCCAATGACAGT |
| Internal bar code: | GTTAGTTAGTAAACACCTCGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1656 |
| LEAP-Seq percent confirming: | 97.4359 |
| LEAP-Seq n confirming: | 38 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGTTGCGCTTGTTCACGA |
| Suggested primer 2: | AGGGAGAAGGGGGCTTAGAG |