| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.032485 |
| Chromosome: | chromosome 12 |
| Location: | 21162 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g483500 | (1 of 1) PF06101//PF12624//PF16908//PF16910 - Plant protein of unknown function (DUF946) (DUF946) // N-terminal region of Chorein or VPS13 (Chorein_N) // Vacuolar sorting-associated protein 13, N-terminal (VPS13) // Repeating coiled region of VPS13 (VPS13_mid_rpt) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTACATTCATAGCTTTCTAACGATCCGATCACTTCCGCGCACTTCCTT |
| Internal bar code: | AGCCTGTGTGGCCAGGCGTCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 266 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTGGTTGCATACTGCCTT |
| Suggested primer 2: | GGACTGTTCCAGCCTGTCTC |