| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.032499 |
| Chromosome: | chromosome 6 |
| Location: | 791816 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g255050 | (1 of 1) PTHR24188:SF44 - E3 UBIQUITIN-PROTEIN LIGASE XBAT35-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGATACACACAGGTCACGCCACGTCAGCCCCCAAACCCGCCCCTGGCG |
| Internal bar code: | ATTAGGATTTTCGCCGCGGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2998 |
| LEAP-Seq percent confirming: | 98.1481 |
| LEAP-Seq n confirming: | 53 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGTAGCTCTTCATCCCCCA |
| Suggested primer 2: | TAGTAGTAGGAGCCGGTGGG |