| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.032549 |
| Chromosome: | chromosome 17 |
| Location: | 1035146 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g703400 | (1 of 3) PTHR11207//PTHR11207:SF7 - RIBONUCLEASE III // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCGCCGGCGCCTCGGCCGGCGGCGGCGCTACGGGCCGTAGTGGCTGC |
| Internal bar code: | GAGGCTCACTGCTTGGACGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 925 |
| LEAP-Seq percent confirming: | 75.7576 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTATGCGCCCCTGTTCCAAT |
| Suggested primer 2: | GTATACTCTGGGTCTGCCGC |