Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.032679 |
Chromosome: | chromosome 6 |
Location: | 5740623 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g288550 | ECP76 | 76 kDa extracellular polypeptide; (1 of 5) PF06742//PF06863 - Protein of unknown function (DUF1214) (DUF1214) // Protein of unknown function (DUF1254) (DUF1254) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTCCAGTGTGGGCGAGCGGATGATGCCGGTCAGGTCCTGTGAGGCAGC |
Internal bar code: | GATCGCCCCGTGGTACACGGTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2519 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 50 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACGGTGTGTCGCTCTACT |
Suggested primer 2: | GTAGGTAGGACACGCGGATG |