| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.032689 |
| Chromosome: | chromosome 10 |
| Location: | 4756528 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g452600 | (1 of 1) PTHR33911:SF1 - RRNA-PROCESSING PROTEIN EFG1 | gene_edge/mRNA_edge/5'UTR | |
| Cre10.g452650 | TIM17 | Mitochondrial inner membrane translocase subunit; (1 of 1) K17795 - mitochondrial import inner membrane translocase subunit TIM17 (TIM17) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGAAGCGTCCGCAAGCCCAGGCCAACCCCGCGCTTTCTAGCAGGCCAA |
| Internal bar code: | AGCTGGCATAATTAAATTACAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1339 |
| LEAP-Seq percent confirming: | 90.6977 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTTGTGACGAAGCAGCTGC |
| Suggested primer 2: | ATTCCAGCCCCCATCTTGTG |