| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.032794 |
| Chromosome: | chromosome 3 |
| Location: | 4383101 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g174900 | (1 of 5) PF00536 - SAM domain (Sterile alpha motif) (SAM_1) | 3'UTR | |
| Cre03.g174950 | TGL7 | (1 of 3) PTHR21493//PTHR21493:SF87 - CGI-141-RELATED/LIPASE CONTAINING PROTEIN // SN1-SPECIFIC DIACYLGLYCEROL LIPASE BETA; Putative triacylglycerol lipase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACGCCAGCTCGGCGGCGAAGGCGAAGCCGTGCAGGTACAGCAGCGGAC |
| Internal bar code: | AGAGCTGAGAATCCGGTATTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 900 |
| LEAP-Seq percent confirming: | 85.0 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTCACCACGATTACGCCA |
| Suggested primer 2: | CGCACAACATCGCATGCATA |