Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.032814 |
Chromosome: | chromosome 6 |
Location: | 8143948 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g305850 | SMM20 | (1 of 2) PTHR12176:SF28 - S-ADENOSYL-L-METHIONINE-DEPENDENT METHYLTRANSFERASE-LIKE PROTEIN; S-adenosyl-L-methionine-dependent methyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACATGGCGCAGGGAGTACTGGAACGCCCGTTACACAAACCAACCCTGCG |
Internal bar code: | AGGAAGGTGATTGGACTCCAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1276 |
LEAP-Seq percent confirming: | 88.8889 |
LEAP-Seq n confirming: | 16 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCATGCTTCTTCCGCATCTG |
Suggested primer 2: | TTCAAAGCTTCAAACGCCGG |