| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.032820 |
| Chromosome: | chromosome 14 |
| Location: | 487356 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g611051 | (1 of 4) IPR001810//IPR020683 - F-box domain // Ankyrin repeat-containing domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCCATCTTGCCGCCCCTACAGGCGGCCTGGGCGGCAAGCGACAGCCGC |
| Internal bar code: | TTTTTGACGATCTAAGTTATTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1335 |
| LEAP-Seq percent confirming: | 96.6667 |
| LEAP-Seq n confirming: | 29 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCATCGATGACAGGGAGCTC |
| Suggested primer 2: | GCAGTGACGACGATGGAGAA |