| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.032845 |
| Chromosome: | chromosome 6 |
| Location: | 4964852 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g281350 | LON1 | (1 of 1) K08675 - Lon-like ATP-dependent protease [EC:3.4.21.-] (PRSS15, PIM1); Mitochondrial LON protease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCCTCCCTCCTGCCATCCCCCCCCCCCACACACACCATAGGCCACCAG |
| Internal bar code: | TTACGTCATGCTGTATTAAATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 386 |
| LEAP-Seq percent confirming: | 21.0526 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTACTACGTTCCCCCTGA |
| Suggested primer 2: | GCGGATTAAGGAGATGGGGG |