| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.032857 |
| Chromosome: | chromosome 3 |
| Location: | 5561405 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g185350 | BGS3,CALS1,GTR9,GTR15 | Callose synthase 1; (1 of 2) K11000 - callose synthase [EC:2.4.1.-] Glc b1-3 Glc (CALS) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCTTCGCGCCCTTTGACCTGGCGGTGCTGTCCAGCGCCGTGGTCACGC |
| Internal bar code: | ACGTGTGCAGGCGGCGCACCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5059 |
| LEAP-Seq percent confirming: | 47.0588 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 68 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCTCTTGGCCATGACTGC |
| Suggested primer 2: | CTGGGCTATGACGACGTGAA |