Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.032883 |
Chromosome: | chromosome 10 |
Location: | 1092546 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g425251 | (1 of 5) IPR008274 - Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCCGCCGCCGTTGTGGCAGCCGCTGCGTCGTCGGCCGCTCGTGCGGCG |
Internal bar code: | TGTAGGGACGGCGCTTGTTTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2035 |
LEAP-Seq percent confirming: | 70.0 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACGAGCGGCCAATGACG |
Suggested primer 2: | CAGCCACTGCGTCATTGG |