| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.032887 |
| Chromosome: | chromosome 17 |
| Location: | 6508896 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g744647 | (1 of 587) 2.7.11.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGATCAAACCACTCCAGCCGGGGTTGCATGGACAGCCTTGCGTACGGG |
| Internal bar code: | TCCATCGACAGTCTCATCAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1815 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACCCTCCCACAGAATCC |
| Suggested primer 2: | AACTAACGTGTGGTAGCGCA |