Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.032949 |
Chromosome: | chromosome 6 |
Location: | 1950283 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g264750 | HTA14 | Histone H2A; (1 of 30) K11251 - histone H2A (H2A) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGCAGCAGAGCCGTCCTCAGCCTTGCCGCCCTTGGTCTTCTTGGGCAG |
Internal bar code: | CCAACGGGGTAAATAAATCAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3512 |
LEAP-Seq percent confirming: | 94.4444 |
LEAP-Seq n confirming: | 102 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 108 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACCCAACACAATGGCTGG |
Suggested primer 2: | CCTCCCACGCTTTGTTTGTG |