Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.032981 |
Chromosome: | chromosome 12 |
Location: | 1663303 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g486550 | (1 of 31) IPR003590 - Leucine-rich repeat, ribonuclease inhibitor subtype | 3'UTR | |
Cre12.g486551 | PFH19,PHX19 | Putative prolyl 4-hydroxylase; (1 of 1) 1.14.11.7 - Procollagen-proline 3-dioxygenase / Prolyl 3-hydroxylase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCCCGTCTGCACCTGTTCGCCACCCAGCCAGCCTCAGTCCGTGCGCCC |
Internal bar code: | CGTACGGTTGTGGACTGGGTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1676 |
LEAP-Seq percent confirming: | 86.6667 |
LEAP-Seq n confirming: | 26 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGAGACGCCACAGACAAGG |
Suggested primer 2: | TCACCCACATCTCGCAGAAC |