| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.033013 |
| Chromosome: | chromosome 6 |
| Location: | 4317584 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278263 | (1 of 4) 2.3.1.84 - Alcohol O-acetyltransferase / AATASE | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCGGGGGCCATCGCCATGGCAAAGCTCCTTGCCTCGGCGGTGGCTCT |
| Internal bar code: | GGGCATCGAGAAGATAAAGATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1059 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGGGGAGGAAGCAAAGAG |
| Suggested primer 2: | CTCCCGCTCGCTGTATTGAT |