Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.033072 |
Chromosome: | chromosome 3 |
Location: | 5700546 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g186800 | (1 of 2) PF00665//PF07727//PF14223 - Integrase core domain (rve) // Reverse transcriptase (RNA-dependent DNA polymerase) (RVT_2) // gag-polypeptide of LTR copia-type (UBN2) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCGGCCTGACATTGCCTACGCGCTGAGCCTACTCGCACGGCATATGGC |
Internal bar code: | CGGCATGAAATGGTTAGTTTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2808 |
LEAP-Seq percent confirming: | 62.5 |
LEAP-Seq n confirming: | 20 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTTGGGCAATACTCCACCG |
Suggested primer 2: | AGGGCCTTGACTTTGACGAG |