| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.033079 |
| Chromosome: | chromosome 9 |
| Location: | 6715447 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g417000 | GT90F20,GT90-20 | (1 of 4) PTHR12203//PTHR12203:SF35 - KDEL LYS-ASP-GLU-LEU CONTAINING - RELATED // SUBFAMILY NOT NAMED; GT90 family protein 20 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCTGGCCAGAGATTGGCGCAGCGTCTTACGCGGTGCTGCACCAACGC |
| Internal bar code: | GGTCGATAAGACGCGTGGACAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1947 |
| LEAP-Seq percent confirming: | 91.6667 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACCACAAGTTCGGACAAC |
| Suggested primer 2: | ATACCTATTGGCCGCTCTGC |