| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.033099 |
| Chromosome: | chromosome 2 |
| Location: | 6397117 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g388150 | MRPL36,bL36m | Mitochondrial ribosomal protein L36; (1 of 1) PTHR18804:SF13 - 39S RIBOSOMAL PROTEIN L36, MITOCHONDRIAL | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTGAGTGGAAGCAGAGCGCGTCGACACACATGTTGCCACATACGTACT |
| Internal bar code: | GTACAGCCAGCGGCCTCCTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3118 |
| LEAP-Seq percent confirming: | 91.4634 |
| LEAP-Seq n confirming: | 75 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 82 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGAGTACACGCGATGGATG |
| Suggested primer 2: | CTGAAGGGCTGTTGTTGCAC |