| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.033105 |
| Chromosome: | chromosome 13 |
| Location: | 5195053 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g607500 | KU70 | ATP-dependent DNA helicase 2 subunit KU70; (1 of 1) K10884 - ATP-dependent DNA helicase 2 subunit 1 (XRCC6, KU70, G22P1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTCCAATCCCAACTGATGGGGGAGTGTGCATGCGAAGGAAACATAACG |
| Internal bar code: | ATTCCTCTTTACTATAGATTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 944 |
| LEAP-Seq percent confirming: | 71.4286 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTAACGCTTCATGTTCCGC |
| Suggested primer 2: | CTGTAGGCATGCGTTGATGC |