Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.033131 |
Chromosome: | chromosome 14 |
Location: | 2683656 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g801640 | (1 of 20) IPR010095//IPR013083 - Transposase IS605, OrfB, C-terminal // Zinc finger, RING/FYVE/PHD-type | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACCTGCCATCCCACTTACCCACACAGTCCCGCAGTGTTGGCACACTTG |
Internal bar code: | GGAGGGGGGCTCGACTTGGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2230 |
LEAP-Seq percent confirming: | 60.0 |
LEAP-Seq n confirming: | 36 |
LEAP-Seq n nonconfirming: | 24 |
LEAP-Seq n unique pos: | 60 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTCGCAGCAATTAGGTTC |
Suggested primer 2: | CTTGCAAGGGAAAAGTGGGC |