| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.033142 |
| Chromosome: | chromosome 7 |
| Location: | 4372427 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g341000 | (1 of 4) IPR017956//IPR020478 - AT hook, DNA-binding motif // AT hook-like | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGGGCATGCTGCGCGTGCGTTTCGGATGCGGCATGTGCGCGGCCTGCC |
| Internal bar code: | TACACAAGTATTAAGGTGGAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2383 |
| LEAP-Seq percent confirming: | 93.1818 |
| LEAP-Seq n confirming: | 41 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATCCAGTGGCATCTCGTC |
| Suggested primer 2: | GGCGGACCTGGCATTACTT |