Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.033183 |
Chromosome: | plastome |
Location: | 68957 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802282 | psaA_exon3,ChreCp019,2717000 | photosystem I P700 apoprotein A1 transpliced exon 3 of 3; (1 of 1) K02689 - photosystem I P700 chlorophyll a apoprotein A1 (psaA) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCATCTTCCAGCTGAAGTGGAAAATTACAATTGATAAGCTGTTGTACAT |
Internal bar code: | GTCCACCATATTAAGGGGATCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2107 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCTCACCACATGTACGCAA |
Suggested primer 2: | GCGTCTACCATTCCGCCATA |