| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.033228 |
| Chromosome: | chromosome 9 |
| Location: | 4572037 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g401293 | SULTR3,SUL3 | Sulfate transporter; (1 of 1) PTHR11814//PTHR11814:SF111 - SULFATE TRANSPORTER // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCATCATGGGGGTGCATTCAGCTAACGGAAATGGTAGACATGGAATGG |
| Internal bar code: | CGTATTGGAAAGTAACCTTGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3985 |
| LEAP-Seq percent confirming: | 95.7576 |
| LEAP-Seq n confirming: | 158 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 165 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATCCTCACCACCCAATCA |
| Suggested primer 2: | ATGGTCTACCGGCTACCACT |